У меня есть последовательность постов
> seq1
UUUAAAAUCUGUGUAGCUGUCGCUCGGCUGCAUGCCUAGUGCACCUACGCAGUAUAAA
Хотите добавить это на веб-сервер *1001* * И затем получить результат (только таблицу результатов) из: http://bioinformatics.hitsz.edu.cn/iMiRNA-SSF/showresult.jsp в выходной текстовый файл.
Я попытался следующий код, который не работает.
post задание
curl -X POST -d 'seq1 \ nUUUAAAAUCUGUGUAGCUGUCGCUCGGCUGCAUGCCUAGUGCACCUACGCUGUAUAAA' http://bioinformatics.hitsz.edu.cn/iMiRNA-SSF/ -H "Тип содержимого: приложение / json"
получить * curl -X POST http://bioinformatics.hitsz.edu.cn/iMiRNA-SSF/showresult.jsp/response -H "Content-Type: text / plain"; эхо Не могли бы вы помочь. У меня есть 1000 таких последовательностей. Мне нужно автоматизировать его с терминала Linux. прикрепил скрипт perl, который работает не полностью. Любое предложение, редактировать?
#!/usr/bin/perl
use LWP::Simple;
use LWP::UserAgent;
use HTTP::Request;
use HTTP::Response;
# Script parameters
# Script hidden parameters
$idCon="12345";
# Sequences source file
# IMPORTANT! use standard fasta file format
$inputFile="file.fa";
# Maximum number of sequences per request
$maxNumOfSequences=1;
# If you want to skip the N first requests
$skipRequests=0;
# Output files prefix
$outputFile="result_ssf";
# Promoter script URL
$URL = "http://bioinformatics.hitsz.edu.cn/iMiRNA-SSF/";
# Header and bottom line
$header = "sequenceName; primaryStru; secondStru; Pvalue; Classification\n";
#$URL2 = "http://bioinformatics.hitsz.edu.cn/iMiRNA-SSF/showresult.jsp";
##################################################################################
# The browser
printf "Creating the browser...\n";
$browser = LWP::UserAgent->new();
$browser->timeout(30);
printf "Opening input file...\n";
open(SEQUENCES, "<".$inputFile) or die $!;
printf "Opening output file...\n";
open OUTPUTFILE, ">".$outputFile or die $!;
printf OUTPUTFILE $header;
$sequences = "";
$sequenceName="";
$currentSec=0;
$currentRequest=0;
printf "Sending request...\n";
while(<SEQUENCES>) {
if ($sequenceName eq "") {
$sequenceName = $_;
} else {
$sequences = $sequences.$sequenceName.$_;
$currentSec = $currentSec+1;
$sequenceName = "";
}
if ($currentSec == $maxNumOfSequences) {
$currentRequest=$currentRequest+1;
if ($currentRequest > $skipRequests ) {
printf " # Request num. ".$currentRequest."\n";
my $response = $browser->post($URL,
[ "Predict" => $sequences,
"uploadFile" => ""
],
"Content_Type" => "form-data" );
if ($response->is_error()) {
printf "%s\n", $response->status_line;
exit 1;
}
$response = $browser->post($URL, ["showresult.jsp"]);
if ($response->is_error()) {
printf "%s\n", $response->status_line;
exit 1;
}
$contents = $response->content();
#$contents =~ s/(<BR>\n|<BODY>|<\/BODY>|<HEAD>|<\/HEAD>|<HTML>|<\/HTML>|<META(.*)>|<TITLE>(.*)<\/TITLE>)//ig;
$contents =~ s/(<BR>\n|<BODY>|<\/BODY>|<HEAD>|<\/HEAD>|<HTML>|<\/HTML>|<META(.*)>|<table>(.*)<\/table>)//ig;
if ($contents =~ m/$header(.*)\n\n-/s) {
print OUTPUTFILE $1;
print OUTPUTFILE "\n";
}
}
$currentSec = 0;
$sequences = "";
}
}
close OUTPUTFILE;
close SEQUENCES;